Protocol
Purpose – a method for synthesis of iRNA which allows both RNA strands to be
generated simultaneously from a PCR fragment which contains a T7 promoter on each
end.
Background - The optimum length of a double-strand RNA (dsRNA) for maximum
interference activity is unclear, but some circumstantial evidence suggests that lengths of
700 to 800 bp are most active. Carthew’s lab has found that dsRNAs as short as 200 bp
and as long as 2000 bp have potent interfering activities. The dsRNA can be made from
cDNA or genomic DNA templates. Data suggests that for RNAi most of the dsRNA
should correspond to exon regions. dsRNAs with two or more exon regions interrupted
by introns will work quite well in Drosophila. One can use dsRNAs corresponding to
coding sequence and/or untranslated regions (UTRs). One approach has been to use a
dsRNA corresponding to the 5' or 3' UTR (either UTR can mediate interference) since a
dsRNA to one gene can cross-interfere with another gene's activity if the dsRNA is
sufficiently similar in coding sequence to the second gene.
Methods
Method
1. Choose primer sequences that will amplify the region you want to act as the dsRNA
template. Consider using MIT's Primer3 program at http://www.genome.wi.mit.edu//cgibin/
primer/primer3_www.cgi to choose optimal primer sequences for any given region.
Complementary sequences should be 20 to 24 nt in length with a 22 nt optimum and
60°C optimum Tm.
2. The 5' end of each primer can correspond to either the 27 nt “T7 promoter sequence”
(TAATACGACTCACTATAGGGAGACCAC) [Carthew] or the 27 nt “T7 RNA
polymerase binding site” (GAATTAATACGACTCACTATAGGGAGA) [Clemens].
Thus, each primer will be 47 to 51 nt long (27 + [20 to 24]).
3. Perform a 50μl PCR reaction with T7-linked primers and suitable template. Cloned
plasmids or phage are optimal, but the method will also work on RT-PCR DNA or
genomic DNA. The first 10 cycles should have a 40°C annealing step, followed by 35
cycles with a 55°C annealing step.
4. Phenol-chloroform extract and ethanol precipitate in NH4OAc. Dissolve in TE buffer
and measure concentration spectrophotometrically. Clemens purified PCR products
using high pure PCR purification kit [Roche Molecular Biochemicals]
5. Perform an RNA synthesis reaction in 50μl volume with 1μg of PCR DNA template
using T7 RNA polymerase. Most labs use in vitro transcription kits Megascript T7 or
mMessage mMachine [Ambion]
6. Remove DNA template with RNase-free DNAase [Tuschl used RQ1 Dnase –
Promega]. Phenol-chloroform extract and precipitate the RNA with NH4OAc and
Ethanol.
7. Dissolve the dsRNA in TE buffer and measure yield by spectrometer. Typical yields of
RNA from 1 μg DNA template are in the 80 to 100μg range.
8. Aliquot and store dsRNA as a NaOAc/ethanol precipitate at -80°C until immediately
before use. Carthew’s lab states that the RNA becomes double-stranded during the
synthesis reaction. [NOTE - Some labs perform annealing step. Clemens resuspends in
H2O and stores at –20*C.]
9. Test the dsRNA’s condition by native agarose gel electrophoresis in TBE.
Electrophorese 6-10μg of RNA and stain with ethidium bromide. Alternatively, tracelabel
RNA with 32P-ATP during synthesis, and visualize electrophoresed products by
autoradiography. [NOTE - Only preparations in which the electrophoretic mobility of
most of the RNA is shifted to that expected for dsRNA (very close to duplex DNA
mobility) of the appropriate length should be used. Sometimes you will observe a smear
of higher-order RNAs migrating slower than the dsRNA species. Although these may
constitute over half of the RNA present, Carthew found that the interfering activities of
these preparations are similar to more homogeneous preparations
