MicroRNA and siRNA Cloning Protocol


Posted by ychoi
Download Protocol
AttachmentSize
PDF icon miRNAcloning.pdf0 bytes
Protocol
Materials: 


OLIGOS FOR SMALL RNA CLONING


Underline nucleotides mark a Ban I restriction digest site (G↓GYRCC)
3' End Donor Oligo (available from IDT Inc. as the miRNA cloning linker)
App17.91x: AppCTGTAGGCACCATCAddA
Note: To synthesize this oligo in your lab, see the original 2001 version of the cloning protocol on the Bartel Lab website.


5' End Acceptor Oligo (RNA/DNA version, lowercase RNA)
17.93R: ATCGTaggcaccugaaa
3' RT Primer Oligo (Shorter 5' end to minimize mispriming)
15.22: ATTGATGGTGCCTAC
3' Linker PCR oligo
17.92: ATTGATGGTGCCTACAG
5' Linker PCR oligo
17.93D: ATCGTAGGCACCTGAAA
TOPO-TA Screening/Sequencing Primers
M13F: GTAAAACGACGGCCAG
M13R: CAGGAAACAGCTATGAC
Small RNA Markers for following miRNAs and siRNAs
(markers should be 5' end labeled and gel-purified after labeling).
24 bp marker (synthetic sequence from an RNA ligase ribozyme; underlined bases mark an Acl-I site)
44.12R: GGCCAACGUUCUCAACAAUAGUGA
18 bp marker (underlined bases mark a BamH-I site)
18.113R: AGCGUGUAGGGAUCCAAA


Other recommended special items to purchase:


32P-γ-ATP (6000 ci/mmol)
T4 Polynucleotide Kinase
Vertical electrophoresis unit for acrylamide gels
Siliconized Tubes
Aerosol Filter tips
T4 RNA Ligase
Glycogen
Superscript III Reverse Transcriptase
Ban-I restriction enzyme
Metaphor GTG Agarose

Methods: 

• 5' End Label Marker RNAs
Kinase RNA markers to very high specific activity by the following procedure:
1 μL of 1 μM RNA (44.12R or 18.113R)
Incubate for 1 hr at 37 oC.
Gel-purify labeled RNA on a 20% denaturing acrylamide gel, using glycogen as a carrier to precipitate after eluting from gel slice.
2 μL PNK Buffer
1 μL PNK
5 μL 6000 Ci/mmol 32P γ-ATP (3μM)
11 μL dH2O
Resuspend each labeled RNA in 40 μL dH2O. Run 2 ul on a test acrylamide gel and wrap the wet test acrylamide gel. Expose to phosphorimage plate and see if you detect a strong signal after a 5 minute exposure. Generally, 3000 counts of labeled RNA is a good starting point to test. The goal is to determine the minimum amount of labeled RNA to add to your total RNA during the purification step of 18-26-mers. Minimizing the addition of marker RNAs will maximize the number of miRNA/siRNA clones in the final step.


• Purifying 18-26mers from Total RNA
Pour a 15% 1.5 mm denaturing polyacrylamide gel with wide wells (23mm). Prerun to warm up
gel. Make sure the lane is quite flat for nice loading and resolution of markers.
Prepare an aliquot of total RNA (50-500 μg), adding trace but very high specific activity
radiolabeled marker RNA and 1X volume of 8M Urea, 0.5 mM EDTA Loading Dye. Heat for 5
min in 80o C heatblock and load entire volume in one lane. Electrophorese until the BB dye
reaches the bottom. Expose gel, cut out gel slice that includes both top and bottom hot markers.
Elute RNAs O/N in 0.3M NaCl, precipitate in 2X volume EtOH (>2 hrs) with glycogen (1 μg/ ml). Spin down (full speed, 30 min) and resuspend in 10 μl dH2O.
A Note on Total RNAs: not all total RNA sources, particularly commercial total RNA sources, may contain small RNAs like miRNAs and siRNAs! If a sample of “total” RNA was purified by the popular silica matrix column procedure (i.e. Qiagen RNEasy columns), it will be significantly depleted in small RNAs. Extraction procedures like Trizol/TriReagent, however will purify all RNAs, large and small, and are the recommend methods for isolating total RNA from biological samples that will contain miRNAs/siRNAs.

• 3' Adaptor Ligation and Purification
Prepare 5X T4 RNA Ligase Buffer (no ATP) taken from England et al. PNAS. 1977. 74: 4839.
250 mM Hepes pH 8.3
50 mM MgCl2
Use RNase-free reagents and techniques. Store buffer at –20oC
16.5 mM DTT
50 ug/ml BSA
41.5% glycerol
Set a 3' Adaptor Ligation Reaction; Incubate at Room Temp for 2 hrs
2 μL 5x Ligation Buffer
2 μL 100 μM App17.91x
1 μL T4 RNA Ligase (Promega or GE Amersham, FPLC pure)
5 μL purified small RNAs (containing hot labeled RNA markers)
Stop reaction with 15 μL 2X Urea Loading Dye.
Prepare a 10% (0.5 mm) denaturing polyacrylamide gel. Prerun, then load into 2-4 lanes (spread out the reaction to prevent overloading and to dilute the salt in the reaction). Run gel until good separation of BB and XC dyes (about 3-4 inches).
Separate one of the plates, keeping gel on other plate, and cover with Saran wrap. Expose on a phosphor plate, and locate ligated bands (higher mobility- see Figure 1.). Cut out the gel slice that includes the 35'mer and 41'mer ligation product and transfer into siliconized tubes. Avoid the upper and lower ligation artifacts (which occur due to the high ligation efficiency of the adenylated linker). Elute RNAs from gel slice, and ethanol precipitate with glycogen. Resuspend all pellets together into 10 μL dH2O.

5' Adaptor Ligation and Purification
Set a 5' Adaptor Ligation Reaction; Incubate at Room Temp for 6 hrs
2 μL 5x Ligation Buffer
2 μL 200 μM 17.93R
1 μL 4 mM ATP
1 μL T4 RNA Ligase
5 μL small RNAs from 3’ Adaptor Ligation Reaction
Stop reaction with 10 μL 2X Urea Loading Dye. Prepare gel and purify 5' adaptor ligation products in the same way as for the 3' ligation products. For band identification, use freshly kinased 10bp ladder as a reference for size. Cut out the 52-60'mer products, and leave behind the unligated 35-43'mers (see Figure 2). Resuspend pellets in a total 10 μL dH2O.

RT-PCR of small RNAs with Adaptors
Using siliconized tubes, set up a reverse transcription reaction:
5 μL of ligated RNAs
Heat to 80oC for 2 min Spin down to cool
1 μL 100 μM 15.22
10 μL dH2O
6 μL 5X First Strand Buffer (Invitrogen)
Heat to 48oC for 2 min before adding RT. Take out 3 μL for a (-)RT control.
7 μL 10X dNTP’s
3 μL 100mM DTT
1 μL SuperScript III RT (200U/μL) final

Incubate reverse transcription reaction at 48oC for 1 hour.

Next, add 1 μL RNase H and incubate at 37oC for 30 minutes. Do all steps in parallel with the (-)RT control. Remaining RT reaction may be stored long term at -20oC.
Set up 100 μL reactions for the RT(+) and RT(-) samples for PCR.
5 μL of RT reaction
10 μL 10X PCR Buffer
10 μL 10X dNTPs
1 μL 100 μM 17.92
1 μL 100 μM 17.93D
2 μL Taq Polymerase
10X Bartel Lab PCR Buffer
100 mM Tris pH 8.3
500 mM KCl
15 mM MgCl2
0.1% Gelatin
1X dNTPs contain 0.2mM of each dNTP
15 to 25 cycles of PCR (hot start optional)
94o C – 30 sec
50o C – 30 sec
72o C – 30 sec
71 μL dH2O
Analyze reactions with a 15% denaturing polyacrylamide gel. Take 3 μL from each RT-PCR reaction, add loading dye, heat well before loading, and load onto a pre-run midi-thickness gel.
Run using the 10bp ladder to follow bands. Do not use EtBr for staining, because the sensitivity
is very weak for these small DNAs. Use the SYBR Gold stain from Molecular Dynamics. You should see a good smear in the size range of small RNAs ligated with linkers. Use filter tips.
Two times phenol extract. Two times chloroform extract. Add NaCl to make 0.3M / EtOH
precipitate (glycogen optional). Spin down pellet and resuspend the RT(+) reaction in 40 μL.

Concatamerization
40 μL of RT-PCR products (Pool 2 tubes)
30 μL NEBuffer 4
10 μL Ban I 20U/μL → 0.67 U final
220 μL dH2O
Check 10 μL from digestion on a 15% denaturing polyacrylamide gel. Use 1 μL from the PCR and the 10 bp ladder as markers, then stain the gel with SYBR Gold. See Figure 4. Two times phenol extract. Two times chloroform extract. Add NaCl to make 0.3M and EtOH precipitate (glycogen optional).

Add the following for concatamerization to the entire pellet from the digest:
8 μL dH2O
1 μL 10X T4 Ligase Buffer (USB or NEB brand is fine)
1 μL T4 DNA Ligase
Incubate at room temp for 30 min. Take a mini-gel casting tray for agarose and rinse thoroughly. Prepare a 2% GTG Nusieve Agarose Gel with 1x TAE, pre-stained with EtBr. Load entire concatamerization reaction with glycerol loading dye into a lane, run with 100bp marker. Run a short time, when the ladder can be visualized. See Figure 5 below.
Using the low energy, high wavelength setting on transilluminator, locate smear corresponding
>300 bp concatamers and cut out with a clean razor blade. Add 10 volumes gel melting solution
(20 mM TrisHCl pH 8, 1 mM EDTA pH 8) and melt for 5 minutes at 65oC. You may need to distribute this to a couple of siliconized tubes.
Add an equal volume of phenol, vortex for 20 seconds, chill on ice for 5 min, then spin at 5000
g for 10 min (4o C). Remove aqueous phase, re-extract with a 1:1 phenol, chloroform mix, and
re-extract again finally with just chloroform. Add 0.06 volume of 5M NaCl and 2.5 volume EtOH and precipitate at –20oC with glycogen for >2 hrs.

Cloning into TOPO vector
Resuspend concatamers in the following Taq Fill In Reaction. Incubate at 72oC for 5 min.
11.5 μL dH2O
1.5 μL 10x PCR Buffer
1.5 μL dNTPs
0.5 μL Taq polymerase
Have the TOPO TA cloning kit reaction tube set up. Use 5 μL from the fill in reaction for a TOPO-TA Cloning reaction, and freeze the remaining fill-in reaction for storage. Use all of Topo reaction for transformation into chemical competent cells, add 500 μl SOC media, and let the cells grow for only 45 min (not longer) before plating out 50 μL , 150 μL, and 300 μL of the culture on to LB Amp S-Gal plates. Grow overnight at 37oC.
• Screen and Sequence
Pick white colonies, and restreak on a master plate. Let this master plate grow ON. Screen only white colonies by PCR in a 96-well microplate format – 30 μL reactions per well.
25 cycles of PCR using the COLONY Protocol
94o C – 3 min (burst open cells)
94o C – 30 sec
50o C – 30 sec
72o C – 30 sec
3 μL 10X PCR Buffer
3 μL 10X dNTPs
0.2 μL 100 μM M13F
0.2 μL 100 μM M13R
0.5 μL Taq Polymerase
23 μL dH2O
Pick colonies from master plates with a pipette tip, swish around in a PCR reaction well. Check completed reactions on a 2% agarose gel, and look for inserts greater than 220 bp (expect 500-800 bp inserts, see Figure 6). You can now either purify remaining PCRs and sequence directly, or regrow colonies to extract plasmids. Submit to commercial sequencing facility, using M13F or M13R as sequencing primers.
Figure 6. PCR Screening of Topo Colonies.
– ladder
Positive colonies containing concatamers of small RNA clones
Product from empty Topo vector